MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set
Manufacturer: MilliporeSigma™
Select a Size
| Pack Size | SKU | Availability | Price |
|---|---|---|---|
| Each of 1 | 17-100-32MI-Each-of-1 | In Stock | ₹ 53,561.42 |
17-100-32MI - Each of 1
In Stock
Quantity
1
Base Price: ₹ 53,561.42
GST (18%): ₹ 9,641.056
Total Price: ₹ 63,202.476
Antigen
Trimethyl-Histone H3 (Lys36)α
Classification
Monoclonal
Formulation
Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Gene Symbols
H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Immunogen
KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Quantity
25 Assays
Research Discipline
Epigenetics, Nuclear Function
Gene ID (Entrez)
NP_003484
Includes
This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Content And Storage
-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Isotype
IgG
Applications
ChIP Assay, Dot Blot, Functional Assay, Western Blot
Conjugate
Unconjugated
Gene Accession No.
Q16695
Host Species
Rabbit
Purification Method
Protein A purified
Regulatory Status
RUO
Primary or Secondary
Primary
Test Specificity
Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Target Species
Chicken, Human
Form
Purified
Related Products
Description
- Specifically detects Trimethyl-Histone H3 (Lys36)α Clone: in Chicken, Human samples, and it is validated for ChIP, Dot Blot, Functional Assay, Western Blotting Histones are highly conserved proteins that serve as the structural scaffold for the organization of nuclear DNA into chromatin
- The four core histones, H2A, H2B, H3, and H4, assemble into an octamer (2 molecules of each)
- Subsequently, 146 base pairs of DNA are wrapped around the octamer, forming a nucleosome, the basic subunit of chromatin
- Histones are modified post-translationally by the actions of enzymes in both the nucleus and cytoplasm
- These modifications regulate DNA transcription, repair, recombination, and replication
- The most commonly studied modifications are acetylation, phosphorylation, methylation, and ubiquitination
- These modifications can alter local chromatin architecture, or recruit trans-acting factors that recognize specific histone modifications (the histone code hypothesis)
- The modifications occur predominantly on the N-terminal and C-terminal tails that extend beyond the nucleosome core particle
- Methylation of histone H3 on Lys36 (H3K36me2/3) is tightly associated with actively transcribed genes, and this modification is found primarily within the coding region, suggesting H3K36 methylation is necessary for efficient RNA polymerase II elongation and processivity.
Compare Similar Items
Show Difference
Antigen: Trimethyl-Histone H3 (Lys36)α
Classification: Monoclonal
Formulation: Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Gene Symbols: H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Immunogen: KLH-conjugated, synthetic peptide containing the sequence ....GVme3KKP…, in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Quantity: 25 Assays
Research Discipline: Epigenetics, Nuclear Function
Gene ID (Entrez): NP_003484
Includes: This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Content And Storage: -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Isotype: IgG
Applications: ChIP Assay, Dot Blot, Functional Assay, Western Blot
Conjugate: Unconjugated
Gene Accession No.: Q16695
Host Species: Rabbit
Purification Method: Protein A purified
Regulatory Status: RUO
Primary or Secondary: Primary
Test Specificity: Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Target Species: Chicken, Human
Form: Purified
Antigen: EED
Classification: Polyclonal
Formulation: Anti-EED (Rabbit polyclonal IgG). One vial containing 50μg of affinity purified antibody in 50μL of 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. Normal rabbit IgG. 1 vial containing 125μg of purified rabbit IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Gene Symbols: EED, WAIT-1
Immunogen: A synthetic peptide corresponding to a.a. 429-441 of human EED, conjugated to KLH.
Quantity: 25 Assays
Research Discipline: Epigenetics and Nuclear Function
Gene ID (Entrez): NP_003788
Includes: This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Content And Storage: -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Isotype: __
Applications: ChIP Assay, Western Blot
Conjugate: Unconjugated
Gene Accession No.: O75530
Host Species: Rabbit
Purification Method: __
Regulatory Status: RUO
Primary or Secondary: Primary
Test Specificity: Recognizes EED, Mr 62 to 70kDa.
Target Species: Bovine, Canine, Chicken, Human, Mouse, Opossum, Rat
Form: Purified
Antigen: __
Classification: __
Formulation: __
Gene Symbols: __
Immunogen: __
Quantity: __
Research Discipline: __
Gene ID (Entrez): __
Includes: __
Content And Storage: __
Isotype: __
Applications: __
Conjugate: __
Gene Accession No.: __
Host Species: __
Purification Method: __
Regulatory Status: __
Primary or Secondary: __
Test Specificity: __
Target Species: __
Form: __
